Python Forum
Search Results
Post Author Forum Replies Views Posted [asc]
    Thread: Guidance in Creating random output for a variable.
Post: Guidance in Creating random output for a variable.

Hi - This thread is not for problem solving but for giving tools into creating a code for a certain idea (tried to find a solution in certain threads in the forum but to no avail) so here it is: I ...
Livne_ye General Coding Help 1 2,482 May-04-2019, 12:50 PM
    Thread: reverse list, incl. nested list
Post: RE: reverse list, incl. nested list

(Apr-29-2019, 04:00 PM)perfringo Wrote: For general purpose solution recursion seems suitable. However, in case of one level deep and only lists then oneliner will do ("for every element in reverse ...
Livne_ye General Coding Help 3 3,107 May-04-2019, 12:34 PM
    Thread: reverse list, incl. nested list
Post: reverse list, incl. nested list

I am trying to write a code which will generate a nested list and the main list in a reverse order: 1.my_third_list = ["WHAT","IS","THIS",["a nested list", 3, 8, 4.00]] meaning, once i print the cod...
Livne_ye General Coding Help 3 3,107 Apr-29-2019, 03:08 PM
    Thread: Changing a character in a string
Post: RE: Changing a character in a string

(Mar-12-2019, 09:54 PM)Larz60+ Wrote: looks like a genetic sequence What have you tried? We're glad to help, but don't generally write the code for you. But since this is so simple: >>> zz ...
Livne_ye General Coding Help 4 2,674 Mar-13-2019, 09:08 AM
    Thread: Changing a character in a string
Post: Changing a character in a string

Hello fellas! first time here. i have the following string: "ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGACGATCGATATCGATGCATCGACTACTAT" i want to write a command which will replac...
Livne_ye General Coding Help 4 2,674 Mar-12-2019, 09:46 PM

User Panel Messages

Announcements
Announcement #1 8/1/2020
Announcement #2 8/2/2020
Announcement #3 8/6/2020