Python Forum
Question #1: Count symbols
Thread Rating:
  • 0 Vote(s) - 0 Average
  • 1
  • 2
  • 3
  • 4
  • 5
Question #1: Count symbols
#1
In this question, you are given a string s which represents a DNA string. The string s consists of symbols 'A', 'C', 'G', and 'T'. An example of a length 21 DNA string is "ATGCTTCAGAAAGGTCTTACG."
Your task is to write a code which will count the number of times each of the symbols 'A', 'C', 'G', and 'T' occur in s. Your code should generate a list of 4 integers and print it out.
In [1]:
# Here is the DNA string:
​s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
# Type your code here
Reply
#2
You should try it yourself.
Reply
#3
Counter, sorted and list comprehension is one way to go.
I'm not 'in'-sane. Indeed, I am so far 'out' of sane that you appear a tiny blip on the distant coast of sanity. Bucky Katt, Get Fuzzy

Da Bishop: There's a dead bishop on the landing. I don't know who keeps bringing them in here. ....but society is to blame.
Reply
#4
@apurdel: How do you get alnng ?
Reply


Possibly Related Threads…
Thread Author Replies Views Last Post
  How to use list of symbols for sympy calculation in python? tanmaybhise 1 2,828 Mar-01-2020, 10:36 PM
Last Post: Gribouillis

Forum Jump:

User Panel Messages

Announcements
Announcement #1 8/1/2020
Announcement #2 8/2/2020
Announcement #3 8/6/2020