(Dec-15-2017, 10:43 PM)Larz60+ Wrote: Questions:
- The only thing you want to replace are the headers, not the data, correct?
- Also, the header text does not match exactly between files:
- How much is necessary to create unique match (I am assuming anything after the '.' is not part of the match)
Almost there give me another hour or so.
Yes, I only want to replace the headers, not the data.
The original header not matching between files was due to copying the examples from this site into there (it retained the bolding html code (whoops).
Anything after the . is not necessary for a unique match, but it can be used, except that last _[digit]_rc or _[digit].
(Dec-16-2017, 12:58 AM)Larz60+ Wrote: Ok Check this out and get back. I think it's what you are looking for. It replaces everything from the match up to the next '>' record.
It looks for the files to be in a directory named data which is a sub-directory of wherever the code is. You mat want to change this.
you can run it from the command line with a command that looks like:
python WhateverYouCallIt.py -i File1.txt -b File2.txt -o Fileout.txt > data/results.txtcode:
# Replace header in bodyfile with header in header file, writing output to outputfile Larz60+
#
from pathlib import Path import argparse class SwapHeaders: def __init__(self, origfile=None, headerfile=None, outfile=None): self.home = Path('.') self.data = self.home / 'data' self.original_file = self.data / origfile self.header_file = self.data / headerfile self.out_file = self.data / outfile with self.header_file.open() as fh: self.new_data = fh.readlines() self.make_new_file() def get_orig_rec(self): with self.original_file.open() as forig: for line in forig: yield line def get_match(self, match_this, fo): found = False for line in self.new_data: if line.startswith('>'): if found: break if match_this in line: found = True if found: fo.write(line) def make_new_file(self): with self.out_file.open('w') as fo: skip = False for line in self.get_orig_rec(): if line.startswith('>'): if skip: skip = False match = line[1:] x = match.rfind('.') if x: match = match[:x] skip = self.get_match(match, fo) if skip: continue fo.write(line) def debug_main(): SwapHeaders(origfile='File1.txt', headerfile='File2.txt', outfile='Fileout.txt') def main(): parser = argparse.ArgumentParser() parser.add_argument("-i", "--ifile", dest='original_filename', help="Filename where headers are to be replaced", action="store") parser.add_argument("-b", "--bfile", dest='replace_original_filename', help="Filename containing body", action="store") parser.add_argument("-o", "--ofile", dest='out_filename', help="Output filename", action="store") args = parser.parse_args() original_filename = args.original_filename replace_original_filename = args.replace_original_filename out_filename = args.out_filename SwapHeaders(origfile=original_filename, headerfile=replace_original_filename, outfile=out_filename) if __name__ == '__main__': main() # debug_main()partial results:
You state: Ok Check this out and get back. I think it's what you are looking for. It replaces everything from the match up to the next '>' record.
If I'm reading correctly, that is also replacing the sequence data, not just the header.
The output is close to what I'm wanting, but it seems to miss a few headers that it should be replacing, e.g.:
Quote:>Clavigralla_tomentosicollis_gi_512427643_gb_GAJX01006991.1_0_rc
GCTCGAATTATGCAAATACATTCTCGGAAAATGAATATTAGCGTTGATGTAAATTTTGAAGAACTTGCAAGGTCAACAGATGATTTTAATGGTGCTCAGTGCAAAGCAGTTTGTGTAGAA
>Clavigralla_tomentosicollis_gi_512427643_gb_GAJX01006991.1_35_rc
AAATTGAATTTCCTCATCCAAATGAAGATGCCCGTGCTCGAATTATGCAAATACATTCTCGGAAAATGAATATTAGCGTTGATGTAAATTTTGAAGAACTTGCAAGGTCAACAGATGATT
>Anasa_tristis_comp3229_c0_seq1_136_rc
TCAGCCAATCATAGTGGAACCGATTTCCAGTGGAGACGAACTCCGAACTGATATTCATGGAATGGAAACACAAATAAACACTTTAGGTTCTAATAACATTGTATGTGTTCTTTCAACAAC
(Dec-16-2017, 02:39 AM)Larz60+ Wrote: curious about your moniker.
Are (were) you a forth programmer?
No, that's my last name
