Python Forum
List/String seperation issue
Thread Rating:
  • 0 Vote(s) - 0 Average
  • 1
  • 2
  • 3
  • 4
  • 5
List/String seperation issue
#10
It's unclear where III comes from.

But maybe this can help:

(1) Create datastructure to hold sequences:

amino_acids = {**dict.fromkeys(['ATT', 'ATC', 'ATA'], 'Isoleucine'), 
               **dict.fromkeys(['CTT', 'CTC', 'CTA', 'CTG', 'TTA', 'TTG'], 'Leucine'), 
               **dict.fromkeys(['GTT', 'GTC', 'GTA', 'GTG'], 'Valine'),
               **dict.fromkeys(['TTT', 'TTC'], 'Phenylalanine'), 
               **dict.fromkeys(['ATG'], 'Methionine')}
amino_acids is dictionary where DNA codon is key and value is corresponding amino acid:

# amino_acid
{'ATT': 'Isoleucine',
 'ATC': 'Isoleucine',
 'ATA': 'Isoleucine',
 'CTT': 'Leucine',
 'CTC': 'Leucine',
 'CTA': 'Leucine',
 'CTG': 'Leucine',
 'TTA': 'Leucine',
 'TTG': 'Leucine',
 'GTT': 'Valine',
 'GTC': 'Valine',
 'GTA': 'Valine',
 'GTG': 'Valine',
 'TTT': 'Phenylalanine',
 'TTC': 'Phenylalanine',
 'ATG': 'Methionine'}


(2) Chunk DNA sequence:

x = 3
dna = 'ATTCTTTTCATGCTCCTGTTACTAAA'
chunks = [dna[y-x:y]  
         for y in range(x, len(dna)+x, x)  
         if len(dna[y-x:y]) == 3] 
Which nicely chops off trailing AA-s:

['ATT', 'CTT', 'TTC', 'ATG', 'CTC', 'CTG', 'TTA', 'CTA']
(3) Iterate over chunks and replace sequence with amino acid:

>>> [amino_acids[sequence] for sequence in chunks]
['Isoleucine',
 'Leucine',
 'Phenylalanine',
 'Methionine',
 'Leucine',
 'Leucine',
 'Leucine',
 'Leucine']
I'm not 'in'-sane. Indeed, I am so far 'out' of sane that you appear a tiny blip on the distant coast of sanity. Bucky Katt, Get Fuzzy

Da Bishop: There's a dead bishop on the landing. I don't know who keeps bringing them in here. ....but society is to blame.
Reply


Messages In This Thread
List/String seperation issue - by YoungGrassHopper - Sep-19-2019, 01:56 PM
RE: List/String seperation issue - by ichabod801 - Sep-19-2019, 01:58 PM
RE: List/String seperation issue - by perfringo - Sep-20-2019, 06:33 AM
RE: List/String seperation issue - by perfringo - Sep-20-2019, 08:05 AM
RE: List/String seperation issue - by perfringo - Sep-20-2019, 08:47 AM
RE: List/String seperation issue - by perfringo - Sep-20-2019, 11:17 AM
RE: List/String seperation issue - by perfringo - Sep-20-2019, 11:57 AM

Possibly Related Threads…
Thread Author Replies Views Last Post
  List Comprehension Issue johnywhy 5 683 Jan-14-2024, 07:58 AM
Last Post: Pedroski55
  Python List Issue Aggie64 5 1,781 Jun-30-2022, 09:15 PM
Last Post: Aggie64
  List to table issue robdineen 2 1,530 Nov-07-2021, 09:31 PM
Last Post: robdineen
  Last caracter of a string truncated issue when working from the end of the string Teknohead23 3 1,681 Oct-03-2021, 01:08 PM
Last Post: snippsat
  Calculator code issue using list kirt6405 4 2,402 Jun-11-2021, 10:13 PM
Last Post: topfox
  Issue accessing data from Dictionary/List in the right format LuisSatch 2 2,328 Jul-25-2020, 06:12 AM
Last Post: LuisSatch
  connection string issue racone 2 3,841 Feb-03-2020, 02:22 AM
Last Post: racone
  For List Loop Issue Galdain 2 2,142 Dec-31-2019, 04:53 AM
Last Post: Galdain
  Python C API - Issue with string as arugments JRHeisey 2 2,891 Nov-30-2019, 04:53 AM
Last Post: casevh
  IndexError: List index out of range issue Adem 1 3,605 Nov-01-2019, 10:47 PM
Last Post: ichabod801

Forum Jump:

User Panel Messages

Announcements
Announcement #1 8/1/2020
Announcement #2 8/2/2020
Announcement #3 8/6/2020