List/String seperation issue

[YoungGrassHopper]

It's unclear where III comes from.

But maybe this can help:

(1) Create datastructure to hold sequences:

amino_acids = {**dict.fromkeys(['ATT', 'ATC', 'ATA'], 'Isoleucine'), 
               **dict.fromkeys(['CTT', 'CTC', 'CTA', 'CTG', 'TTA', 'TTG'], 'Leucine'), 
               **dict.fromkeys(['GTT', 'GTC', 'GTA', 'GTG'], 'Valine'),
               **dict.fromkeys(['TTT', 'TTC'], 'Phenylalanine'), 
               **dict.fromkeys(['ATG'], 'Methionine')}

amino_acids is dictionary where DNA codon is key and value is corresponding amino acid:

# amino_acid
{'ATT': 'Isoleucine',
 'ATC': 'Isoleucine',
 'ATA': 'Isoleucine',
 'CTT': 'Leucine',
 'CTC': 'Leucine',
 'CTA': 'Leucine',
 'CTG': 'Leucine',
 'TTA': 'Leucine',
 'TTG': 'Leucine',
 'GTT': 'Valine',
 'GTC': 'Valine',
 'GTA': 'Valine',
 'GTG': 'Valine',
 'TTT': 'Phenylalanine',
 'TTC': 'Phenylalanine',
 'ATG': 'Methionine'}

(2) Chunk DNA sequence:

x = 3
dna = 'ATTCTTTTCATGCTCCTGTTACTAAA'
chunks = [dna[y-x:y]  
         for y in range(x, len(dna)+x, x)  
         if len(dna[y-x:y]) == 3] 

Which nicely chops off trailing AA-s:

['ATT', 'CTT', 'TTC', 'ATG', 'CTC', 'CTG', 'TTA', 'CTA']

(3) Iterate over chunks and replace sequence with amino acid:

>>> [amino_acids[sequence] for sequence in chunks]
['Isoleucine',
 'Leucine',
 'Phenylalanine',
 'Methionine',
 'Leucine',
 'Leucine',
 'Leucine',
 'Leucine']

My goodness perfringo , your skills astound me, you sorted this in 2 ticks , only problem is I will not be able to take credit for this work, I will not be able to sleep at night if I had to tell my mentor this was my creation haha. Amazing solution. I only recently learned about dictionaries, and I have never seen it used like that as in the very top section of the code. I will have to read up on it. the basic dictionary below that makes sense to me though.
Thanks for your superb support you are golden