Python Forum
Changing a character in a string
Thread Rating:
  • 0 Vote(s) - 0 Average
  • 1
  • 2
  • 3
  • 4
  • 5
Changing a character in a string
#2
looks like a genetic sequence
What have you tried?
We're glad to help, but don't generally write the code for you.
But since this is so simple:
>>> zz = "ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGACGATCGATATCGATGCATCGACTACTAT"
>>> zz = zz.replace('T', 'U')
>>> zz
'AUCGAUCGAUCGAUCGACUGACUAGUCAUAGCUAUGCAUGUAGCUACUCGAUCGAUCGAUCGACGAUCGAUAUCGAUGCAUCGACUACUAU'
>>>
Reply


Messages In This Thread
Changing a character in a string - by Livne_ye - Mar-12-2019, 09:46 PM
RE: Changing a character in a string - by Larz60+ - Mar-12-2019, 09:54 PM
RE: Changing a character in a string - by Livne_ye - Mar-13-2019, 09:08 AM
RE: Changing a character in a string - by hshivaraj - Mar-12-2019, 10:33 PM
RE: Changing a character in a string - by Larz60+ - Mar-13-2019, 12:39 PM

Possibly Related Threads…
Thread Author Replies Views Last Post
  question about changing the string value of a list element jacksfrustration 4 2,378 Feb-08-2025, 07:43 AM
Last Post: jacksfrustration
  Virtual Env changing mysql connection string in python Fredesetes 0 1,094 Dec-20-2023, 04:06 PM
Last Post: Fredesetes
  Writing string to file results in one character per line RB76SFJPsJJDu3bMnwYM 4 4,113 Sep-27-2022, 01:38 PM
Last Post: buran
  Changing a string value to a numerical value using python code and a lamda function Led_Zeppelin 6 3,061 Jul-05-2022, 11:29 PM
Last Post: deanhystad
Thumbs Up Parsing a YAML file without changing the string content..?, Flask - solved. SpongeB0B 2 3,300 Aug-05-2021, 08:02 AM
Last Post: SpongeB0B
  Regex: a string does not starts and ends with the same character Melcu54 5 3,833 Jul-04-2021, 07:51 PM
Last Post: Melcu54
  [solved] unexpected character after line continuation character paul18fr 4 7,731 Jun-22-2021, 03:22 PM
Last Post: deanhystad
  SyntaxError: unexpected character after line continuation character siteshkumar 2 4,350 Jul-13-2020, 07:05 PM
Last Post: snippsat
  Remove from end of string up to and including some character lbtdne 2 3,183 May-17-2020, 09:24 AM
Last Post: menator01
  how can i handle "expected a character " type error , when I input no character vivekagrey 2 3,751 Jan-05-2020, 11:50 AM
Last Post: vivekagrey

Forum Jump:

User Panel Messages

Announcements
Announcement #1 8/1/2020
Announcement #2 8/2/2020
Announcement #3 8/6/2020